Paired-end fastq quality control with Skewer

Quality trimming and adapter clipping paired end reads is a tricky business. For paired-end alignments to work, the order of the sequences in both files (forward and reverse) needs to be retained. While there are plenty of read trimmers available open-source (think FASTX-toolkit, SeqTK, CutAdapt, etc), I haven't found many that:

  • Retain pairing info
  • Run parallel and are fast
  • Are easy to set up and run
  • Have good docs

Then I fell in love with Skewer. It smashed through 14.5 million gzipped read pairs, doing adapter clipping and quality trimming in two minutes on my 8-core workstation. It auto-detects quality encoding so you can safely analyse any Illumina data. Awesome!

$ skewer -t 8 -q 20 SRR634969.sra_1.fastq.gz SRR634969.sra_2.fastq.gz
Parameters used:
-- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r): 0.100
-- maximum indel error ratio allowed (-d): 0.030
-- end quality threshold (-q): 20
-- minimum read length allowed after trimming (-l): 18
-- file format (-f): Sanger/Illumina 1.8+ FASTQ (auto detected)
-- number of concurrent threads (-t): 8
Thu Mar 19 22:19:26 2015 >> started
|=================================================>| (100.00%)
Thu Mar 19 22:21:31 2015 >> done (124.590s)
14555046 read pairs processed; of these:
   35892 ( 0.25%) short read pairs filtered out after trimming by size control
   21534 ( 0.15%) empty read pairs filtered out after trimming by size control
14497620 (99.61%) read pairs available; of these:
 5122437 (35.33%) trimmed read pairs available after processing
 9375183 (64.67%) untrimmed read pairs available after processing
log has been saved to "SRR634969.sra_1.fastq-trimmed.log".
Location: Saint Kilda VIC 3182, Australia

Popular posts from this blog

Mass download from google drive using R

Google drive is great for sharing documents and other small files but it's definitely not suited to moving  many large files around. For example I just received 170 fastq files that are about 200 MB in size. If you use the browser to download the whole folder, the web app will zip the contents for you which will take a LOOONG time. Alternatively you can download each and every one of those files one by one, which is annoying and prone to human error. You can insist to your collaborators to transfer in a different way, but there are not that many user-friendly and economic approaches. Your biologist collaborators probably won't be able to use rsync  to get the data to you safely. And fast convenient tools for moving around large files like Hightail cost a lot of money. A good solution to this problem is to use the R package googledrive  which enables command line automation of tasks that might take a long time manually. The package vignette has a good overview of the main comma
Read more

Data analysis step 8: Pathway analysis with GSEA

Image
In our RNA-seq series so far we've performed differential analysis and generated some pretty graphs, showing thousands of differentially expressed genes after azacitidine treatment. In order to understand the biology underlying the differential gene expression profile, we need to perform pathway analysis. We use Gene Set Enrichment Analysis ( GSEA ) because it can detect pathway changes more sensitively and robustly than some methods. A 2013 paper compared a bunch of gene set analyses software with microarrays and is worth a look. Generate a rank file The rank file is a list of detected genes and a rank metric score. At the top of the list are genes with the "strongest" up-regulation, at the bottom of the list are the genes with the "strongest" down-regulation and the genes not changing are in the middle. The metric score I like to use is the sign of the fold change multiplied by the inverse of the p-value, although there may be better methods out there
Read more

Extract properly paired reads from a BAM file using SamTools

For a few different types of sequence analysis I need to extract read pairs that are properly mapped and satisfy some map quality filter, but I always forget the command line. So here it is: To read pairs from a bam file (-b) that map with mapQ≥30 including the bam file header (-h). The -f 0x2 option corresponds to the bitwise flags that specify that reads need to be properly paired. Proper pairing means reads are in Read1 forward, Read2 reverse orientation or Read1 reverse, Read2 forward orientation. $ samtools view -q 30 -f 0x2 -b -h in.bam > out.bam To extract single end reads from a bam file (-b) that map with mapQ≥30 including the bam file header (-h). $ samtools view -q 30 -b -h in.bam > out.bam
Read more